forward and reward primers Search Results


forward and reverse primers  (Qiagen)
90
Qiagen forward and reverse primers
Forward And Reverse Primers, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/Qiagen
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
forward and reverse primers  (Biomics Biotechnologies)
90
Biomics Biotechnologies forward and reverse primers
Forward And Reverse Primers, supplied by Biomics Biotechnologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/Biomics Biotechnologies
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
forward and reverse primers  (Midland Certified Reagent)
90
Midland Certified Reagent forward and reverse primers
Forward And Reverse Primers, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/Midland Certified Reagent
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
forward and reverse primers  (GeneWorks)
90
GeneWorks forward and reverse primers
Forward And Reverse Primers, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/GeneWorks
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
primer: thrap3_i2 reverse: caagcagaagacggcatacgagatacatcg attggcctggttcggtcttctc  (Eurofins Genomics)
90
Eurofins Genomics primer: thrap3_i2 reverse: caagcagaagacggcatacgagatacatcg attggcctggttcggtcttctc
Primer: Thrap3 I2 Reverse: Caagcagaagacggcatacgagatacatcg Attggcctggttcggtcttctc, supplied by Eurofins Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer: thrap3_i2 reverse: caagcagaagacggcatacgagatacatcg attggcctggttcggtcttctc/product/Eurofins Genomics
Average 90 stars, based on 1 article reviews
primer: thrap3_i2 reverse: caagcagaagacggcatacgagatacatcg attggcctggttcggtcttctc - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
the primer pair encodes forward and reverse barcodes for amplicon sequencing  (Pacific Biosciences)
90
Pacific Biosciences the primer pair encodes forward and reverse barcodes for amplicon sequencing
The Primer Pair Encodes Forward And Reverse Barcodes For Amplicon Sequencing, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/the primer pair encodes forward and reverse barcodes for amplicon sequencing/product/Pacific Biosciences
Average 90 stars, based on 1 article reviews
the primer pair encodes forward and reverse barcodes for amplicon sequencing - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
mouse primers  (Metabion International AG)
90
Metabion International AG mouse primers
Mouse Primers, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse primers/product/Metabion International AG
Average 90 stars, based on 1 article reviews
mouse primers - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
barcoded forward primer and reverse primer mix biolegio bv  (Biolegio bv)
90
Biolegio bv barcoded forward primer and reverse primer mix biolegio bv
Barcoded Forward Primer And Reverse Primer Mix Biolegio Bv, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/barcoded forward primer and reverse primer mix biolegio bv/product/Biolegio bv
Average 90 stars, based on 1 article reviews
barcoded forward primer and reverse primer mix biolegio bv - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
labelled forward primers  (Microsynth ag)
90
Microsynth ag labelled forward primers
Labelled Forward Primers, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/labelled forward primers/product/Microsynth ag
Average 90 stars, based on 1 article reviews
labelled forward primers - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
300 nm each forward and reverse bdnf primers  (Mobix Inc)
90
Mobix Inc 300 nm each forward and reverse bdnf primers
300 Nm Each Forward And Reverse Bdnf Primers, supplied by Mobix Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/300 nm each forward and reverse bdnf primers/product/Mobix Inc
Average 90 stars, based on 1 article reviews
300 nm each forward and reverse bdnf primers - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
il28b forward and reverse primers  (Qiagen)
90
Qiagen il28b forward and reverse primers
Il28b Forward And Reverse Primers, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/il28b forward and reverse primers/product/Qiagen
Average 90 stars, based on 1 article reviews
il28b forward and reverse primers - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
forward and reverse primers ( each, macrogen)  (Macrogen)
90
Macrogen forward and reverse primers ( each, macrogen)
Forward And Reverse Primers ( Each, Macrogen), supplied by Macrogen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers ( each, macrogen)/product/Macrogen
Average 90 stars, based on 1 article reviews
forward and reverse primers ( each, macrogen) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results